SMAD4, SMAD family member 4, 4089

N. diseases: 575; N. variants: 144
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs9304407
rs9304407
1.000 0.040 18 51069023 intron variant C/G snv 0.55
CUI: C0009324
Disease: Ulcerative Colitis
Ulcerative Colitis
Digestive System Diseases 0.010 1.000 1 2019 2019
dbSNP: rs878854769
rs878854769
1.000 0.120 18 51059867 stop gained G/A snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs878854765
rs878854765
1.000 0.120 18 51067083 frameshift variant -/T delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs876660720
rs876660720
18 51076669 frameshift variant AGGCGGCTACTGCACAAGCTGCAGCAGC/-;AGGCGGCTACTGCACAAGCTGCAGCAGCAGGCGGCTACTGCACAAGCTGCAGCAGC delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs876660556
rs876660556
18 51065555 missense variant G/A;C snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 3 2007 2013
dbSNP: rs876660150
rs876660150
18 51078392 frameshift variant -/TT delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs876660079
rs876660079
18 51048733 stop gained G/A snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs876658694
rs876658694
18 51059892 stop gained C/T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs869312781
rs869312781
1.000 0.080 18 51058435 frameshift variant CCCCATCCCG/- delins
CUI: C0007102
Disease: Malignant tumor of colon
Malignant tumor of colon
Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs869312781
rs869312781
1.000 0.080 18 51058435 frameshift variant CCCCATCCCG/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs864622252
rs864622252
1.000 0.120 18 51078320 frameshift variant T/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs863224507
rs863224507
1.000 0.120 18 51067021 stop gained T/A snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs80338965
rs80338965
0.851 0.480 18 51067121 frameshift variant CAGA/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 12 1998 2017
dbSNP: rs80338965
rs80338965
0.851 0.480 18 51067121 frameshift variant CAGA/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 11 1998 2017
dbSNP: rs80338965
rs80338965
0.851 0.480 18 51067121 frameshift variant CAGA/- delins
JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder)
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs80338965
rs80338965
0.851 0.480 18 51067121 frameshift variant CAGA/- delins
CUI: C0796081
Disease: Myhre syndrome
Myhre syndrome
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Male Urogenital Diseases; Nervous System Diseases; Endocrine System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs80338965
rs80338965
0.851 0.480 18 51067121 frameshift variant CAGA/- delins
CUI: C0235974
Disease: Pancreatic carcinoma
Pancreatic carcinoma
Digestive System Diseases; Neoplasms; Endocrine System Diseases 0.700 0
dbSNP: rs80338964
rs80338964
1.000 0.120 18 51067041 stop gained C/T snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs80338963
rs80338963
0.776 0.280 18 51065548 missense variant C/A;G;T snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.800 1.000 14 1997 2016
dbSNP: rs80338963
rs80338963
0.776 0.280 18 51065548 missense variant C/A;G;T snv
CUI: C0009404
Disease: Colorectal Neoplasms
Colorectal Neoplasms
Digestive System Diseases; Neoplasms 0.700 1.000 8 1996 2016
dbSNP: rs80338963
rs80338963
0.776 0.280 18 51065548 missense variant C/A;G;T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 6 1998 2016
dbSNP: rs80338963
rs80338963
0.776 0.280 18 51065548 missense variant C/A;G;T snv
CUI: C0007873
Disease: Uterine Cervical Neoplasm
Uterine Cervical Neoplasm
Neoplasms; Female Urogenital Diseases and Pregnancy Complications 0.700 1.000 1 2016 2016
dbSNP: rs80338963
rs80338963
0.776 0.280 18 51065548 missense variant C/A;G;T snv
Squamous cell carcinoma of the head and neck
Neoplasms 0.700 1.000 1 2016 2016
dbSNP: rs80338963
rs80338963
0.776 0.280 18 51065548 missense variant C/A;G;T snv
CUI: C0152018
Disease: Esophageal carcinoma
Esophageal carcinoma
Digestive System Diseases; Neoplasms 0.700 1.000 1 2016 2016
dbSNP: rs80338963
rs80338963
0.776 0.280 18 51065548 missense variant C/A;G;T snv
CUI: C0152013
Disease: Adenocarcinoma of lung (disorder)
Adenocarcinoma of lung (disorder)
Neoplasms 0.700 1.000 1 2016 2016